OpenArt
OpenArt
Workflows
Go to OpenArt main site
Upload workflow
Post Not Found"blackhole pointillism"

Oops!
We did not found the page you are looking for.

Prompt: A traditional Japanese riverside landscape in horizontal format, with soft watercolor and ink brush style, as if painted on aged rice paper. In the background, gentle mountains rise up, partially shrouded in mist. On the upper right corner, a medium-sized sakura tree branch extends from right to left, partially framing the scene. On the left side of the image, depict an old Japanese village with 2–3 wooden buildings in Edo period style, near the riverbank. The overall mood should be calm, nostalgic, and harmonious, evoking traditional Japanese aesthetics.
Prompt: A realistic, professional-quality photo of the latest roofing company vehicles — including clean, branded pickup trucks and work vans — parked in front of a modern commercial office building in the state of Connecticut. The vehicles are clearly marked with a realistic company logo and contact details, which also appears on the building facade or office signage. The company name is "Xpert Roofing Pro." The setting should include seasonal landscaping appropriate for Connecticut (late summer: green grass, bright skies, light cloud cover), and the overall photo should look natural, as if taken by a commercial photographer. The vehicles are white and charcoal gray, well-maintained, with ladder racks and tool storage, parked neatly in front of the building. Avoid any elements that make the image look AI-generated. Ensure proportions, reflections, shadows, and angles are natural. The company office has a glass door and windows, with visible signage and branding.
Prompt: <mymodel> with shiny straight hair. wears black framed glasses, and a low cut dress. Dynamic overhead stage lighting, vibrant atmosphere, captivating energy, (photorealistic), high-resolution, ultra-detailed, professional photography, (stunning visuals), 4K
Prompt: The woman is looking down slightly toward the camera from above, her curls framing her face in motion. Her white t-shirt is visible as the golden light hits her tan skin. Striking green eyes are intense and joyful.
Prompt: Both men are sitting on a bed in a hotel holding beers and smoking cigars
Prompt:
Prompt: With captivating green eyes framed by dramatic lashes, the model presents a striking appearance highlighted by her dark red lips and flawless complexion. Her softly curled hair, adorned with a decorative piece, gently frames her face, while intricate earrings catch the light, adding elegance to her look. The model's hand, posed delicately near her face, enhances the composition, showcasing meticulously manicured nails that contrast beautifully with her skin tone. Set against a muted green background, the image exudes a rich and sophisticated atmosphere, merging modern beauty with classic elements in a gloriously refined manner. The overall effect is one of confidence and allure, inviting admiration.
Prompt:
Prompt:
Prompt: Generate an image of a Nighthawk, a Phoenix in flames, an Infinite Drake in Frost and the word Epoch in bold font with a medieval theme.
Prompt: A futuristic dual-personality AI character, angelic side with glowing blue halo, gentle smile, soft facial features, large white wings, kind and supportive expression, fiery mischievous side with red halo, mischievous grin, intense eyes, small curved horns matching angelic side, bold and witty demeanor, seamless blend of light and dark elements, dynamic contrast, digital art style, vibrant lighting highlighting both personalities, waist-up portrait, ultra-detailed, 4K quality.
Prompt: she stands up as the views zooms out, she walks forwards slowly, sensual and emotionally charged, magical and serene, as the camera zooms out and pans wider,
Prompt: Tilt up from the open book to the rocket, ending on the laptop screen.
Prompt:
Prompt: One tall Asian guy walk on the beach, suddenly it have a shark jump on the beach and say tralalero tralala
Prompt: # T-Rex RNA genetic code dictionary genetic_code_trex = { "AUG" => "M", # Start codon "UUU" => "F", "UUC" => "F", "UUA" => "L", "UUG" => "L", "CUU" => "L", "CUC" => "L", "CUA" => "L", "CUG" => "L", "AUU" => "I", "AUC" => "I", "AUA" => "I", "GUU" => "V", "GUC" => "V", "GUA" => "V", "GUG" => "V", "UCU" => "S", "UCC" => "S", "UCA" => "S", "UCG" => "S", "CCU" => "P", "CCC" => "P", "CCA" => "P", "CCG" => "P", "ACU" => "T", "ACC" => "T", "ACA" => "T", "ACG" => "T", "GCU" => "A", "GCC" => "A", "GCA" => "A", "GCG" => "A", "UAU" => "Y", "UAC" => "Y", "UAA" => "*", "UAG" => "*", "UGA" => "*", "CAU" => "H", "CAC" => "H", "CAA" => "Q", "CAG" => "Q", "AAU" => "N", "AAC" => "N", "AAA" => "K", "AAG" => "K", "GAU" => "D", "GAC" => "D", "GAA" => "E", "GAG" => "E", "UGU" => "C", "UGC" => "C", "UGG" => "W", "CGU" => "R", "CGC" => "R", "CGA" => "R", "CGG" => "R", "AGU" => "S", "AGC" => "S", "AGA" => "R", "AGG" => "R", "GGU" => "G", "GGC" => "G", "GGA" => "G", "GGG" => "G" } # Function to translate DNA to a T-Rex protein on Mars def translate_dna_to_protein_trex(dna_sequence, genetic_code) rna_sequence = dna_sequence.tr("T", "U") protein_sequence = "" codon_size = 3 (0...rna_sequence.length).step(codon_size) do |i| codon = rna_sequence[i, codon_size] break if codon.length < 3 # Avoid incomplete codons amino_acid = genetic_code[codon] || "X" protein_sequence += amino_acid end protein_sequence end # Mars-based T-Rex DNA example dna_sequence = "ATGCTACGTCGTGCATACGATAGCTA" # Translate and simulate protein_sequence_trex = translate_dna_to_protein_trex(dna_sequence, genetic_code_trex) puts "🦖 T-Rex Protein sequence on Mars: #{protein_sequence_trex}" puts "🧬 Interaction complete. Martian T-Rex expresses #{protein_sequence_trex.count("M")} start sites and #{protein_sequence_trex.count("*")} a bio engneerd trex
Prompt: A vibrant and dynamic high-quality painting showcasing a circle of sleek sports cars, each painted in striking colors like deep red, electric blue, and glossy black. The setting is a sun-drenched racetrack, where the asphalt glimmers with tire marks under the warm golden light of a late afternoon sun. Shadows stretch playfully beneath the cars, enhancing their polished exteriors. Surrounding the circle, a cheering crowd is faintly visible, bathed in the warm glow of a fading summer sky, while ethereal clouds drift lazily above. This scene captures the thrilling energy of performance and luxury, rendered in a photorealistic style that highlights the intricate details and sheen of the cars.
Prompt: Create a motion video for an event stage background, modern and professional style. Include vibrant stage lighting effects, smooth-moving lasers and LED lights. Main color tones: blue, white, metallic silver. Incorporate elements of technology and luxury. Aspect ratio: 16:9, resolution: Full HD or 4K. No sound. Continuous motion with depth, suitable as a stage backdrop for conferences or corporate events.
Prompt: Bathed in the captivating glow of a sunset, a young woman elegantly poses on a lavish balcony adorned with intricate architectural details. She wears a stunning gown that features a fitted, intricately embroidered bodice in soft beige, flowing into a sheer, cascading train that hints at shades of lavender. Her expressive gaze, combined with delicate hairstyles and subtle jewelry, evokes a sense of sophistication and grace. In the background, the silhouette of a city skyline illuminated by dusk showcases notable landmarks, while the fading daylight casts a warm hue, adding to the romantic atmosphere of the scene. The overall composition, with its blend of beauty and grandeur, conveys a narrative of timeless elegance.
Prompt: <mymodel> with shiny straight hair. wears black framed glasses, and a low cut dress. Dynamic overhead stage lighting, vibrant atmosphere, captivating energy, (photorealistic), high-resolution, ultra-detailed, professional photography, (stunning visuals), 4K
Prompt: A vertical 9:16 cinematic close-up of a dazzling baby gecko perched delicately on a twisted obsidian branch. Its skin glows in deep sapphire blue, shimmering with encrusted micro-gemstones that flicker like tiny stars. Oversized, round obsidian-black eyes reflect a galaxy of starbursts—hyper-detailed and glossy. Fluffy peach ear tufts sway slightly with the forest breeze. Its jewel-lined tail curls elegantly into the soft blur of the background, catching scattered moonlight glints like crushed crystals. The backdrop glows with the surreal bioluminescence of a dark fairytale forest, bathed in rich indigo shadows and subtle teal highlights. A luminous round moon hovers behind mist-draped branches, creating diffused halo flares. The gecko’s tiny breath puffs in visible glow as it shifts gently. Aspect Ratio: 9:16 vertical • Studio-quality lighting with cinematic ambient shadows • Ultra-shallow depth of field • 30 FPS slow cinematic movement • Hyper-realistic photoreal textures • Perfect golden ratio focal framing
Prompt: <mymodel> with pale, shiny skin, strong bone structure, (shiny straight black hair) and wears (thin black rimmed glasses). Dynamic overhead stage lighting, vibrant atmosphere, captivating energy, (photorealistic), high-resolution, ultra-detailed, professional photography, (stunning visuals), 4K
Prompt:
Prompt: comic book illustration, full color, thick watercolor), (a two-tone, dull green on top and yellow on bottom, Hiroshima streetcar) over a the Aioi bridge, with Hiroshima peace park in the background, a beautiful summer day
Prompt:
Prompt: Nestled among bustling shops, the entrance of Hotel Narayana stands out with its intricately carved facade and vibrant orange trim, evoking a sense of warm hospitality. A well-dressed doorman in a crisp uniform attentively stands at the door, welcoming guests with a polite smile. The atmosphere is lively, with local patrons mingling casually on the sidewalk, while colorful signage of nearby shops adds to the vibrant street scene. The hotel’s design reflects a blend of traditional architecture and modern comfort, set against a sunny day that casts soft shadows over the pavement. Overall, the scene conveys a welcoming mood and a slice of everyday life in this bustling location.
Prompt: Woman dance Belli dance
Prompt:
Prompt: Visual Idea: • Model perempuan berdiri tegak, memegang beg PU Leather di tangan kiri (elegant style). • Model lelaki di sebelah kanan, sandang beg di bahu (business casual look). • Kamera zoom out perlahan-lahan dari beg ke badan atas model (half body shot). • Background plain minimalist (cream or beige) supaya beg lebih menyerlah.
Prompt: Man is talking
Prompt: a lightning bolt fires out of a high tech hand gun being held by a statue
Prompt: Image Prompt for Poster Design: A dynamic action movie poster set in tropical Guadeloupe. Foreground: Mikaël Godec in a sharp tuxedo, running in a James Bond–style pose with confident determination. Flanking him: a glamorous blonde co-star (Sylviane Godec), elegantly dressed, exuding intrigue and allure. Background: vibrant Caribbean scenery with lush palm trees, blue sea, and dramatic sky. Explosions, speeding motorbike chase, and roaring helicopters emphasize high-stakes excitement. Fiery cinematic drama and subtle lens flares add intensity. Overall, the vibe is polished, vibrant, and thrilling—a Hollywood blockbuster with a tropical twist. Text Layout Suggestions: Main Title (at the bottom, bold & dramatic): Saveur la Guadeloupe Subtitle/tagline just below or above the title (smaller, but eye-catching): Starring Mikaël Godec as James Bond Optional: At the top or corner, add: A Cinematic Caribbean Adventure Font Suggestions: Main Title: Use a bold, modern sans-serif or a classic action-movie font. Try: “Bebas Neue” “Oswald Bold” “Agency FB” For a Bond-like flair: “Gunplay” or “Eurostile Bold Extended” Tagline/Subtitles: Use a sleek, clean sans-serif like “Montserrat” or “Futura” for contrast. Keep correct spelling of Mikaël, don't with ë Color Suggestions: White or metallic gold for the title (over a subtle dark drop shadow). Accent with hot orange or sunset yellow for action cues (explosions/fire). Use cool teal or deep blue for shadow/highlight balance.
Prompt: Take off the man's jacket and put on the shirt
Prompt: a mid 20th century living room with sofa and coffee table. Its a bright spring morning. Theres a large open glass framed door and bright spring coutryside can be seen outside
Prompt: mountain and waterfall
Prompt:
Prompt:
Prompt: Remove the beer out of the men's hands and put bath towels in their hands
Prompt: a dark blue background. In the center of the upper half, depict a stylized, golden profile of a wolf's head facing right. The wolf should have sharp features, pointed ears, and visible fur details in gold. Below the wolf's head, in a bold, golden sans-serif font, display the text 'KYCHOM 22', centered horizontally.
Prompt: Man is typing on a computer in his bedroom office at nighttime in Chicago. His gray and white pit bull is beside him eating a large white bone.
Prompt: 1990s anime screencap, a school girl sitting, anime scene
Prompt: The young woman turns towards the viewer and walks towards him like a fashion model. Her strap slips off her shoulder and she smiles shyly. The camera slowly zooms out and it is very windy. A masterpiece.
Prompt: Gravity hiccups the moment a confident young man, center-frame in a raw loft of exposed brick and matte-black windows, states: “Roomit.” Instantly, a caramel leather sectional, 85-inch wall TV, neon-lit mini fridge, sneaker-stack shelves, and walnut LED rails free-fall from a glitching ceiling portal like oversized Tetris blocks, slamming into perfect alignment with a visceral camera shake and puff of concrete dust. The barren loft snaps into a cinematic black-and-walnut mancave, under-lit LEDs casting deep, dynamic shadows. Without dropping eye contact, he drops onto the couch, flexing a satisfied half-smile as the lights settle into a moody pulse. Camera rides a smooth waist-high dolly-in, capturing every crash and his cool claim. Audio: thunderous bass slam, tailing into a low synth rumble; lips sync precisely to “Roomit.” Negative prompt: text, subtitles, watermark, logos
Prompt: Buatkan seorang lelaki yang sedang Tidur sambil mengangguk angguk seperti mendengar lagu heavy metal
Prompt: Prompt Ultra-realistic cinematic promo of iX’CHEL Beach Club on a private Caribbean island at golden hour → blue hour. Look & palette: champagne-beige #D8BD8F, antique-gold #B79362, espresso #221409, jade-blue accents. Shot 1 (0–3s, drone dolly-in): aerial reveal of a beachfront infinity-edge pool mirroring the sunset; antique-gold shell-shaped cabanas with subtle Mayan filigree; palms swaying; ocean glints. Shot 2 (3–6s, gimbal slide): pool deck close-up; elegant guests in linen; candles and bamboo torches; water kissing the edge; lens bloom. Shot 3 (6–9s, orbit): crescent DJ booth glowing softly; upbeat deep-house vibe; bartenders craft signature cocktails; sparkle on glass. Shot 4 (9–12s, push-through): service moments: smile, tray pass, cheers; tasteful slow-motion droplets; refined lighting. Shot 5 (12–15s, lock-off): logo iX’CHEL (lowercase i, uppercase X’CHEL) embossed antique-gold with jade patina and faint Mayan shell-motif border; tag: “Private Island • Belize”. Lighting: teal rim light from left, warm amber from right; soft vignette. Mood: luxurious, modern, exclusive; no other brands, no crowds, no bikinis focus; tasteful. Negative prompt low-res, noisy, cartoonish, oversaturated, logos/watermarks, shaky cam, warping faces, rain, storm, trash, clutter, text overlays except brand lock-up. Settings (рекомендации) Duration: 15 s, 24 fps, 16:9 (3840×2160 или 1920×1080). Camera: smooth drone/gimbal motion; gentle ease-in/ease-out; cross-dissolves 8–10 frames. Style strength: medium-high; motion strength: medium; guidance 6–8; seed locked for consistency. Music (если поддерживается): deep/afro-house 110–118 BPM, warm & classy.
Prompt: A poetic visual metamorphosis sequence: Scene 1: A closed hibiscus bud begins to bloom slowly into a vibrant red Malaysian national flower, petals unfolding delicately under soft sunlight, surrounded by tropical greenery. Scene 2: The fully bloomed hibiscus morphs gracefully into a glowing red Chinese lantern (tanglung), floating mid-air, with warm festive lighting and subtle motion blur. Scene 3: The lantern dissolves into colored dust, swirling on the ground and forming a traditional Indian kolam (rangoli) made of colored rice and flour, intricate patterns glowing slightly, surrounded by candles, symbolizing unity in Malaysian multicultural heritage. Ultra detailed, cinematic lighting, soft focus transitions, high resolution, magical realism.